Journal: Cell reports

Article Title: HSPA9 contributes to tumor progression and ferroptosis resistance by enhancing USP14-driven SLC7A11 deubiquitination in multiple myeloma.

doi: 10.1016/j.celrep.2025.115720

Figure Lengend Snippet: Figure 1. HSPA9 is highly expressed in MM, and augmented expression of HSPA9 correlates with poor prognosis (A and B) HSPA9 expression levels in healthy donor (HD) and MM from GSE16558 (A), GSE5900 and GSE2658 (B). (C and D) Expressions of HSPA9 in GSE5900 (C) and GSE6477 (D) datasets. MGUS, monoclonal gammopathy of undetermined significance; SMM, smoldering multiple myeloma. (E–G) Survival analysis of HSPA9 in MMRF CoMMpass (E), GSE2658 (F), and GSE9782 (G). (H) Representative HSPA9 immunohistochemistry (IHC) staining images of the HD, MGUS, and MM samples. (I and J) Relative protein (I) and mRNA (J) levels of HSPA9 in six human MM cell lines, HGC27 (gastric cancer cell), and A2780 (ovarian cancer cell) cells. (K and L) Kaplan-Meier survival curves stratified by HSPA9 expression levels. Data are represented as the mean ± SD (n = 3). *p < 0.05; ***p < 0.001; ****p < 0.0001 by Student’s t test (A–D).

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti-HSPA9 Proteintech Cat#14887-1-AP; RRID: AB_2120458 Rabbit polyclonal anti-SLC7A11 abcam Cat#ab216876; RRID: AB_3678921 Rabbit polyclonal anti-SLC7A11 Proteintech Cat#26864-1-AP; RRID: AB_2880661 Rabbit polyclonal anti-USP14 Proteintech Cat#14517-1-AP; RRID: AB_2257124 Rabbit monoclonal anti-USP14 Cell Signaling Technology Cat#11931; RRID: AB_2721157 Mouse monoclonal anti-GAPDH Proteintech Cat#60004-1-Ig; RRID: AB_2107436 Rabbit polyclonal anti-Ki67 abcam Cat#ab15580; RRID: AB_443209 Rabbit monoclonal anti-Ubiquitin Cell Signaling Technology Cat#20326; RRID: AB_3064918 Mouse monoclonal anti-Myc tag abcam Cat#ab32; RRID: AB_303599 Rabbit monoclonal anti-His tag Sigma-Aldrich Cat#SAB5600227; RRID: AB_3678924 Rabbit polyclonal anti-HA tag abcam Cat#ab9110; RRID: AB_307019 Rabbit monoclonal anti-FLAG tag Sigma-Aldrich Cat#F3165; RRID: AB_259529 Biological samples Paraffin sections from patients the First Affiliated Hospital of Nanjing Medical University N/A Chemicals, peptides, and recombinant proteins MG-132 MedChemExpress Cat#HY-13259 cycloheximide MedChemExpress Cat#HY-12320 chloroquine MedChemExpress Cat#HY-17589A Ferrostatin-1 MedChemExpress Cat#HY-100579 erastin MedChemExpress Cat#HY-15763 IU1 MedChemExpress Cat#HY-13817 Critical commercial assays Cell Counting Kit-8 MedChemExpress Cat#HY-K0301 BCA Protein Assay Kit Thermo Fisher Cat#23225 MDA assay kit Solarbio Cat#BC0025 cDNA synthesis kit Thermo Fisher Cat#K1622 Deposited data HSPA9 mass spectrum This study PXD062159 Proteomic analysis between HSPA9-control and -overexpression cells This study OMIX009744 Experimental models: Cell lines RPMI8226 ATCC (Rockville, USA) CRM-CCL-155 MM1S ATCC (Rockville, USA) Cat#CRL-2974 HEK293T ATCC (Rockville, USA) Cat#CRL-11268 Experimental models: Organisms/strains Mouse: BALB/c nude Vital River Laboratory Animal Technology (Beijing, China) N/A Oligonucleotides PCR primers for HSPA9, 5’- AGCTGGAATGGCCTTAGTCAT -3’ (forward) Sigma-Aldrich N/A PCR primers for HSPA9, 5’- CAGGAGTTGGTAGTACCCAAATC -3’ (reverse) Sigma-Aldrich N/A (Continued on next page) 16 Cell Reports 44, 115720, May 27, 2025

Techniques: Expressing, Immunohistochemistry

Journal: Cell reports

Article Title: HSPA9 contributes to tumor progression and ferroptosis resistance by enhancing USP14-driven SLC7A11 deubiquitination in multiple myeloma.

doi: 10.1016/j.celrep.2025.115720

Figure Lengend Snippet: Figure 2. HSPA9 promotes malignant survival and impedes ferroptosis of MM cells (A) Western blotting analysis was performed to examine the efficiency of HSPA9 overexpression (OE) and knockdown in MM cells. (B) CCK8 assays were used to measure the proliferation of MM cells transfected with vector control, OE-HSPA9, shCtrl, or shHSPA9. (C) Heatmap analysis of differentially expressed proteins (DEPs) in HSPA9 OE compared to HSPA9-vector RPMI-8226 cells.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti-HSPA9 Proteintech Cat#14887-1-AP; RRID: AB_2120458 Rabbit polyclonal anti-SLC7A11 abcam Cat#ab216876; RRID: AB_3678921 Rabbit polyclonal anti-SLC7A11 Proteintech Cat#26864-1-AP; RRID: AB_2880661 Rabbit polyclonal anti-USP14 Proteintech Cat#14517-1-AP; RRID: AB_2257124 Rabbit monoclonal anti-USP14 Cell Signaling Technology Cat#11931; RRID: AB_2721157 Mouse monoclonal anti-GAPDH Proteintech Cat#60004-1-Ig; RRID: AB_2107436 Rabbit polyclonal anti-Ki67 abcam Cat#ab15580; RRID: AB_443209 Rabbit monoclonal anti-Ubiquitin Cell Signaling Technology Cat#20326; RRID: AB_3064918 Mouse monoclonal anti-Myc tag abcam Cat#ab32; RRID: AB_303599 Rabbit monoclonal anti-His tag Sigma-Aldrich Cat#SAB5600227; RRID: AB_3678924 Rabbit polyclonal anti-HA tag abcam Cat#ab9110; RRID: AB_307019 Rabbit monoclonal anti-FLAG tag Sigma-Aldrich Cat#F3165; RRID: AB_259529 Biological samples Paraffin sections from patients the First Affiliated Hospital of Nanjing Medical University N/A Chemicals, peptides, and recombinant proteins MG-132 MedChemExpress Cat#HY-13259 cycloheximide MedChemExpress Cat#HY-12320 chloroquine MedChemExpress Cat#HY-17589A Ferrostatin-1 MedChemExpress Cat#HY-100579 erastin MedChemExpress Cat#HY-15763 IU1 MedChemExpress Cat#HY-13817 Critical commercial assays Cell Counting Kit-8 MedChemExpress Cat#HY-K0301 BCA Protein Assay Kit Thermo Fisher Cat#23225 MDA assay kit Solarbio Cat#BC0025 cDNA synthesis kit Thermo Fisher Cat#K1622 Deposited data HSPA9 mass spectrum This study PXD062159 Proteomic analysis between HSPA9-control and -overexpression cells This study OMIX009744 Experimental models: Cell lines RPMI8226 ATCC (Rockville, USA) CRM-CCL-155 MM1S ATCC (Rockville, USA) Cat#CRL-2974 HEK293T ATCC (Rockville, USA) Cat#CRL-11268 Experimental models: Organisms/strains Mouse: BALB/c nude Vital River Laboratory Animal Technology (Beijing, China) N/A Oligonucleotides PCR primers for HSPA9, 5’- AGCTGGAATGGCCTTAGTCAT -3’ (forward) Sigma-Aldrich N/A PCR primers for HSPA9, 5’- CAGGAGTTGGTAGTACCCAAATC -3’ (reverse) Sigma-Aldrich N/A (Continued on next page) 16 Cell Reports 44, 115720, May 27, 2025

Techniques: Western Blot, Over Expression, Knockdown, Transfection, Plasmid Preparation, Control

Journal: Cell reports

Article Title: HSPA9 contributes to tumor progression and ferroptosis resistance by enhancing USP14-driven SLC7A11 deubiquitination in multiple myeloma.

doi: 10.1016/j.celrep.2025.115720

Figure Lengend Snippet: Figure 3. HSPA9 directly interacts and maintains SLC7A11 stability by diminishing K48-linked polyubiquitination (A) Cell lysates of RPMI-8226 and MM1S cells were immunoprecipitated with immunoglobulin G (IgG) or HSPA9 antibodies, and immunoblot assays were performed using HSPA9 or SLC7A11 antibodies. (B) Cell lysates of RPMI-8226 and MM1S cells were immunoprecipitated with IgG or SLC7A11 antibodies, and immunoblot assays were performed using HSPA9 or SLC7A11 antibodies.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti-HSPA9 Proteintech Cat#14887-1-AP; RRID: AB_2120458 Rabbit polyclonal anti-SLC7A11 abcam Cat#ab216876; RRID: AB_3678921 Rabbit polyclonal anti-SLC7A11 Proteintech Cat#26864-1-AP; RRID: AB_2880661 Rabbit polyclonal anti-USP14 Proteintech Cat#14517-1-AP; RRID: AB_2257124 Rabbit monoclonal anti-USP14 Cell Signaling Technology Cat#11931; RRID: AB_2721157 Mouse monoclonal anti-GAPDH Proteintech Cat#60004-1-Ig; RRID: AB_2107436 Rabbit polyclonal anti-Ki67 abcam Cat#ab15580; RRID: AB_443209 Rabbit monoclonal anti-Ubiquitin Cell Signaling Technology Cat#20326; RRID: AB_3064918 Mouse monoclonal anti-Myc tag abcam Cat#ab32; RRID: AB_303599 Rabbit monoclonal anti-His tag Sigma-Aldrich Cat#SAB5600227; RRID: AB_3678924 Rabbit polyclonal anti-HA tag abcam Cat#ab9110; RRID: AB_307019 Rabbit monoclonal anti-FLAG tag Sigma-Aldrich Cat#F3165; RRID: AB_259529 Biological samples Paraffin sections from patients the First Affiliated Hospital of Nanjing Medical University N/A Chemicals, peptides, and recombinant proteins MG-132 MedChemExpress Cat#HY-13259 cycloheximide MedChemExpress Cat#HY-12320 chloroquine MedChemExpress Cat#HY-17589A Ferrostatin-1 MedChemExpress Cat#HY-100579 erastin MedChemExpress Cat#HY-15763 IU1 MedChemExpress Cat#HY-13817 Critical commercial assays Cell Counting Kit-8 MedChemExpress Cat#HY-K0301 BCA Protein Assay Kit Thermo Fisher Cat#23225 MDA assay kit Solarbio Cat#BC0025 cDNA synthesis kit Thermo Fisher Cat#K1622 Deposited data HSPA9 mass spectrum This study PXD062159 Proteomic analysis between HSPA9-control and -overexpression cells This study OMIX009744 Experimental models: Cell lines RPMI8226 ATCC (Rockville, USA) CRM-CCL-155 MM1S ATCC (Rockville, USA) Cat#CRL-2974 HEK293T ATCC (Rockville, USA) Cat#CRL-11268 Experimental models: Organisms/strains Mouse: BALB/c nude Vital River Laboratory Animal Technology (Beijing, China) N/A Oligonucleotides PCR primers for HSPA9, 5’- AGCTGGAATGGCCTTAGTCAT -3’ (forward) Sigma-Aldrich N/A PCR primers for HSPA9, 5’- CAGGAGTTGGTAGTACCCAAATC -3’ (reverse) Sigma-Aldrich N/A (Continued on next page) 16 Cell Reports 44, 115720, May 27, 2025

Techniques: Immunoprecipitation, Western Blot

Journal: Cell reports

Article Title: HSPA9 contributes to tumor progression and ferroptosis resistance by enhancing USP14-driven SLC7A11 deubiquitination in multiple myeloma.

doi: 10.1016/j.celrep.2025.115720

Figure Lengend Snippet: Figure 4. HSPA9 modulates cell survival, and ferroptosis is SLC7A11 dependent (A) The protein levels of SLC7A11 in RPMI-8226 and MM1S cells transfected as indicated were determined by western blotting. (B) CCK8 assays were used to measure the proliferation of MM cells transfected as indicated. (C–F) The ferroptosis levels in RPMI-8226 and MM1S cells transfected as indicated were determined by iron content (C), mitochondrial morphology (D), MDA (E), and normalized GSH levels (F). (C) Scale bars: 10 μm; (D) scale bars: 200 nm. (G) Representative tumor images in nude mice formed by the RPMI-8226 cells in the different subgroups. Scale bars: 1 cm. (H and I) Quantitative analysis of xenografted tumor volume (H) and weight (I). (J) Representative images of IHC staining of Ki-67 and 4-HNE in different groups. Scale bars: 100 μm. (K) Representative tumor images in nude mice formed by the MM1S cells in the different subgroups. Scale bars: 1 cm. (L) The tumor volume was monitored every 3 days.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti-HSPA9 Proteintech Cat#14887-1-AP; RRID: AB_2120458 Rabbit polyclonal anti-SLC7A11 abcam Cat#ab216876; RRID: AB_3678921 Rabbit polyclonal anti-SLC7A11 Proteintech Cat#26864-1-AP; RRID: AB_2880661 Rabbit polyclonal anti-USP14 Proteintech Cat#14517-1-AP; RRID: AB_2257124 Rabbit monoclonal anti-USP14 Cell Signaling Technology Cat#11931; RRID: AB_2721157 Mouse monoclonal anti-GAPDH Proteintech Cat#60004-1-Ig; RRID: AB_2107436 Rabbit polyclonal anti-Ki67 abcam Cat#ab15580; RRID: AB_443209 Rabbit monoclonal anti-Ubiquitin Cell Signaling Technology Cat#20326; RRID: AB_3064918 Mouse monoclonal anti-Myc tag abcam Cat#ab32; RRID: AB_303599 Rabbit monoclonal anti-His tag Sigma-Aldrich Cat#SAB5600227; RRID: AB_3678924 Rabbit polyclonal anti-HA tag abcam Cat#ab9110; RRID: AB_307019 Rabbit monoclonal anti-FLAG tag Sigma-Aldrich Cat#F3165; RRID: AB_259529 Biological samples Paraffin sections from patients the First Affiliated Hospital of Nanjing Medical University N/A Chemicals, peptides, and recombinant proteins MG-132 MedChemExpress Cat#HY-13259 cycloheximide MedChemExpress Cat#HY-12320 chloroquine MedChemExpress Cat#HY-17589A Ferrostatin-1 MedChemExpress Cat#HY-100579 erastin MedChemExpress Cat#HY-15763 IU1 MedChemExpress Cat#HY-13817 Critical commercial assays Cell Counting Kit-8 MedChemExpress Cat#HY-K0301 BCA Protein Assay Kit Thermo Fisher Cat#23225 MDA assay kit Solarbio Cat#BC0025 cDNA synthesis kit Thermo Fisher Cat#K1622 Deposited data HSPA9 mass spectrum This study PXD062159 Proteomic analysis between HSPA9-control and -overexpression cells This study OMIX009744 Experimental models: Cell lines RPMI8226 ATCC (Rockville, USA) CRM-CCL-155 MM1S ATCC (Rockville, USA) Cat#CRL-2974 HEK293T ATCC (Rockville, USA) Cat#CRL-11268 Experimental models: Organisms/strains Mouse: BALB/c nude Vital River Laboratory Animal Technology (Beijing, China) N/A Oligonucleotides PCR primers for HSPA9, 5’- AGCTGGAATGGCCTTAGTCAT -3’ (forward) Sigma-Aldrich N/A PCR primers for HSPA9, 5’- CAGGAGTTGGTAGTACCCAAATC -3’ (reverse) Sigma-Aldrich N/A (Continued on next page) 16 Cell Reports 44, 115720, May 27, 2025

Techniques: Transfection, Western Blot, Immunohistochemistry

Journal: Cell reports

Article Title: HSPA9 contributes to tumor progression and ferroptosis resistance by enhancing USP14-driven SLC7A11 deubiquitination in multiple myeloma.

doi: 10.1016/j.celrep.2025.115720

Figure Lengend Snippet: Figure 5. USP14 regulates the deubiquitination and stability of SLC7A11 (A) HSPA9-interacting deubiquitinating enzymes were determined by mass spectrometry. (B) HEK293T cells were co-transfected with HA-Ub, His-SLC7A11, siCtrl, or different siDUBs and treated with MG-132 (20 μM for 8 h) before collecting. Cell lysates were subjected to d-IP and western blotting assays.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti-HSPA9 Proteintech Cat#14887-1-AP; RRID: AB_2120458 Rabbit polyclonal anti-SLC7A11 abcam Cat#ab216876; RRID: AB_3678921 Rabbit polyclonal anti-SLC7A11 Proteintech Cat#26864-1-AP; RRID: AB_2880661 Rabbit polyclonal anti-USP14 Proteintech Cat#14517-1-AP; RRID: AB_2257124 Rabbit monoclonal anti-USP14 Cell Signaling Technology Cat#11931; RRID: AB_2721157 Mouse monoclonal anti-GAPDH Proteintech Cat#60004-1-Ig; RRID: AB_2107436 Rabbit polyclonal anti-Ki67 abcam Cat#ab15580; RRID: AB_443209 Rabbit monoclonal anti-Ubiquitin Cell Signaling Technology Cat#20326; RRID: AB_3064918 Mouse monoclonal anti-Myc tag abcam Cat#ab32; RRID: AB_303599 Rabbit monoclonal anti-His tag Sigma-Aldrich Cat#SAB5600227; RRID: AB_3678924 Rabbit polyclonal anti-HA tag abcam Cat#ab9110; RRID: AB_307019 Rabbit monoclonal anti-FLAG tag Sigma-Aldrich Cat#F3165; RRID: AB_259529 Biological samples Paraffin sections from patients the First Affiliated Hospital of Nanjing Medical University N/A Chemicals, peptides, and recombinant proteins MG-132 MedChemExpress Cat#HY-13259 cycloheximide MedChemExpress Cat#HY-12320 chloroquine MedChemExpress Cat#HY-17589A Ferrostatin-1 MedChemExpress Cat#HY-100579 erastin MedChemExpress Cat#HY-15763 IU1 MedChemExpress Cat#HY-13817 Critical commercial assays Cell Counting Kit-8 MedChemExpress Cat#HY-K0301 BCA Protein Assay Kit Thermo Fisher Cat#23225 MDA assay kit Solarbio Cat#BC0025 cDNA synthesis kit Thermo Fisher Cat#K1622 Deposited data HSPA9 mass spectrum This study PXD062159 Proteomic analysis between HSPA9-control and -overexpression cells This study OMIX009744 Experimental models: Cell lines RPMI8226 ATCC (Rockville, USA) CRM-CCL-155 MM1S ATCC (Rockville, USA) Cat#CRL-2974 HEK293T ATCC (Rockville, USA) Cat#CRL-11268 Experimental models: Organisms/strains Mouse: BALB/c nude Vital River Laboratory Animal Technology (Beijing, China) N/A Oligonucleotides PCR primers for HSPA9, 5’- AGCTGGAATGGCCTTAGTCAT -3’ (forward) Sigma-Aldrich N/A PCR primers for HSPA9, 5’- CAGGAGTTGGTAGTACCCAAATC -3’ (reverse) Sigma-Aldrich N/A (Continued on next page) 16 Cell Reports 44, 115720, May 27, 2025

Techniques: Mass Spectrometry, Transfection, Western Blot

Journal: Cell reports

Article Title: HSPA9 contributes to tumor progression and ferroptosis resistance by enhancing USP14-driven SLC7A11 deubiquitination in multiple myeloma.

doi: 10.1016/j.celrep.2025.115720

Figure Lengend Snippet: Figure 6. HSPA9 enhances the interaction between USP14 and SLC7A11 (A and B) Cell lysates of RPMI-8226 (A) and MM1S cells (B) were immunoprecipitated with IgG or USP14 antibodies, and immunoblot assays were performed using USP14, HSPA9, or SLC7A11 antibodies. (C and D) RPMI-8226 (C) and MM1S (D) cells were transfected as indicated and treated with MG-132 (20 μM for 8 h) before collecting. Cell lysates were subjected to IP, followed by western blotting with the indicated antibodies. (E and F) HEK293T (E) and RPMI-8226 (F) cells were transfected as indicated and treated with MG-132 (20 μM for 8 h) before collecting. Cell lysates were subjected to d-IP and western blotting assays. (G and H) HEK293T (G) and RPMI-8226 (H) cells were transfected as indicated and treated with IU1 for 24 h before collecting. Cell lysates were subjected to d-IP and western blotting assays. (I and J) HEK293T (I) and RPMI-8226 (J) cells were transfected as indicated and treated with IU1 for 24 h before collecting. Cell lysates were subjected to western blotting assays. (K and L) HEK293T (K) and RPMI-8226 (L) cells were transfected as indicated and cell lysates were subjected to western blotting assays. Data are represented as the mean ± SD (n = 3). **p < 0.01; ***p < 0.001 by Student’s t test (I–L).

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti-HSPA9 Proteintech Cat#14887-1-AP; RRID: AB_2120458 Rabbit polyclonal anti-SLC7A11 abcam Cat#ab216876; RRID: AB_3678921 Rabbit polyclonal anti-SLC7A11 Proteintech Cat#26864-1-AP; RRID: AB_2880661 Rabbit polyclonal anti-USP14 Proteintech Cat#14517-1-AP; RRID: AB_2257124 Rabbit monoclonal anti-USP14 Cell Signaling Technology Cat#11931; RRID: AB_2721157 Mouse monoclonal anti-GAPDH Proteintech Cat#60004-1-Ig; RRID: AB_2107436 Rabbit polyclonal anti-Ki67 abcam Cat#ab15580; RRID: AB_443209 Rabbit monoclonal anti-Ubiquitin Cell Signaling Technology Cat#20326; RRID: AB_3064918 Mouse monoclonal anti-Myc tag abcam Cat#ab32; RRID: AB_303599 Rabbit monoclonal anti-His tag Sigma-Aldrich Cat#SAB5600227; RRID: AB_3678924 Rabbit polyclonal anti-HA tag abcam Cat#ab9110; RRID: AB_307019 Rabbit monoclonal anti-FLAG tag Sigma-Aldrich Cat#F3165; RRID: AB_259529 Biological samples Paraffin sections from patients the First Affiliated Hospital of Nanjing Medical University N/A Chemicals, peptides, and recombinant proteins MG-132 MedChemExpress Cat#HY-13259 cycloheximide MedChemExpress Cat#HY-12320 chloroquine MedChemExpress Cat#HY-17589A Ferrostatin-1 MedChemExpress Cat#HY-100579 erastin MedChemExpress Cat#HY-15763 IU1 MedChemExpress Cat#HY-13817 Critical commercial assays Cell Counting Kit-8 MedChemExpress Cat#HY-K0301 BCA Protein Assay Kit Thermo Fisher Cat#23225 MDA assay kit Solarbio Cat#BC0025 cDNA synthesis kit Thermo Fisher Cat#K1622 Deposited data HSPA9 mass spectrum This study PXD062159 Proteomic analysis between HSPA9-control and -overexpression cells This study OMIX009744 Experimental models: Cell lines RPMI8226 ATCC (Rockville, USA) CRM-CCL-155 MM1S ATCC (Rockville, USA) Cat#CRL-2974 HEK293T ATCC (Rockville, USA) Cat#CRL-11268 Experimental models: Organisms/strains Mouse: BALB/c nude Vital River Laboratory Animal Technology (Beijing, China) N/A Oligonucleotides PCR primers for HSPA9, 5’- AGCTGGAATGGCCTTAGTCAT -3’ (forward) Sigma-Aldrich N/A PCR primers for HSPA9, 5’- CAGGAGTTGGTAGTACCCAAATC -3’ (reverse) Sigma-Aldrich N/A (Continued on next page) 16 Cell Reports 44, 115720, May 27, 2025

Techniques: Immunoprecipitation, Western Blot, Transfection

Journal: Cell Reports Medicine

Article Title: Dysregulation of FLVCR1a-dependent mitochondrial calcium handling in neural progenitors causes congenital hydrocephalus

doi: 10.1016/j.xcrm.2024.101647

Figure Lengend Snippet:

Article Snippet: Rabbit polyclonal, anti-GRP75 , Proteintech, Rosemont, IL, USA , 14887-1-AP; RRID:AB_2120458.

Techniques: Control, Purification, Marker, Recombinant, Sterility, Protease Inhibitor, Bicinchoninic Acid Protein Assay, ATP Bioluminescent Assay, Reverse Transcription, Transfection, Imaging, SYBR Green Assay, Plasmid Preparation, shRNA, Software, Variant Assay

Journal: Molecular & Cellular Proteomics : MCP

Article Title: Interactome Analysis Identifies the Role of BZW2 in Promoting Endoplasmic Reticulum-Mitochondria Contact and Mitochondrial Metabolism

doi: 10.1016/j.mcpro.2023.100709

Figure Lengend Snippet:

Article Snippet: Antibody , Anti-GRP75 (rabbit polyclonal) , Abclonal , A0558 , WB (1:1000).

Techniques: Cloning, Transfection, Transduction, Construct, Protease Inhibitor, Software, Calcium Assay, Bioassay, Isolation, Viability Assay, Sequencing, Modification, Western Blot, Bicinchoninic Acid Protein Assay